MEDICAL SOCIOLOGY

This week you have to complete your paper on your chosen health problem. The paper should be a minimum of 6 pages and should use a minimum of 5 peer reviewed journal articles. In Week 1 you have been provided with pointers to guide you in developing the final paper. You must have followed them and developed your paper by this time.

 

An error-free document helps to convey your thoughts and intent more completely. Before submitting your paper, do the following:

APA FORMAT

Check your document carefully with an eye for detail.

Proofread your document carefully, making sure that there are no errors pertaining to: noun-verb agreement, pronouns, quotation marks, voice (active versus passive), sentence structure, and commas.

Check the format, text, headings, running heads, citations, and endnotes for completeness and inclusion.

Revise and rewrite your document before handing in your final draft. Include a brief one-page summary and reference list.

YOU DO NOT HAVE TO ANSWER ALL OF THESE ONLY THE ONE RELAVENT TO THE ILLNESS. I HAVENT PICKED AN ILLNESS- this is the pointers guide

Week 5, you have to complete your paper on your chosen health problem. The paper should be a minimum of 6 pages and should use a minimum of 5 peer reviewed journal articles. Use the following pointers to guide you in developing your paper:

 

Provide a clear, specific, definition of your topic. For example, your topic can be on CHD, obesity, or smoking.

How does this topic or health behavior relate to the leading health indicators/focus areas/goals of Healthy People 2020 document? This document can be found at http://www.healthypeople.gov/2020/default.aspx

How is this topic or behavior relevant to community health? How is this topic relevant to other national health campaigns or national health initiatives?

If you are writing about a health behavior, what is the prevalence of this behavior in the United States and your state? Does prevalence differ by gender, race, age, socioeconomic status? Provide some statistics here.

Describe the significance of this topic/health behavior in America today. Discuss any diseases and/or societal problems caused by this behavior. Are there any financial costs or costs to society associated with this topic/behavior?

Describe the risk factors associated with this topic/behavior. What factors lead to this health behavior or disease?

How can the risk factors be controlled or prevented? How can the negative outcomes be prevented? What are the current recommendations for preventing premature morbidity/mortality in this area? Are there any programs that have shown to be effective in the literature?

 

Please identify a minimum of three organizations or healthcare agencies either nationally or locally that provide programs, funding, or resources to address this issue.

Financial Analysis Exercise 1

Answer the questions, no limit for words.

Due: 02-07-2016 10:00 am.

 

 

1. Briefly describe the main point of the article.

 

2. What skills are desired by those hiring accountants that seem to be lacking in the population of those applying for positions?

 

3. What do you think could be driving the change in the skill sets employer’s desire from their accountants?

 

Go to  www.thiswaytocpa.com and answer the following questions

 

4. Select one article from “The Profession” menu and briefly summarize it here.

 

5. Go to “GPA Profiles” within “The Profession” Menu and select one individual. Briefly summarize their role/position.

 

6. Take the “Find Your Fit” assessment under “The profession” menu along the left hand side. What does it suggest as “you early career” type, if you were to go into the accounting field?

 

 

7. Looking through the various menus and tabs, what fact or piece of information did you learn that was new?

 

Week 5 Discussion

I. A double strand of DNA contains the following sequence. 5’ AGTAGGTTTACACTGCTGCCCCACTATCGTATCTTCCCTGAGTGAGCATTG 3’

3’ TCATCCAAATGTGACGACGGGGTGATAGCATAGAAGGGACTCACTCGTAAC 5’

a. Write the 6 reading frames and group nucleotides in codons, i.e. GTACGT= GTA CGT.

b. From the 6 reading frames, is there an open reading frame (ORF)? If yes, which reading frame? Please indicate the start and stop codons in different colors.

 

II. Review blue-white screening in the website below: http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html

 

You are cloning human insulin gene (INS) in the lab using a plasmid, pJET, that contains an ampicillin resistance marker and also a lacZ gene interrupted by a multiple cloning site. You transform the rDNA into competent E. coli cells by electroporation, then plated the transformed E. coli on agar plates containing ampicillin and X-Gal and waited one day until colonies are visible. You then use blue/white screening to help you identify clones that carry INS gene. You observe numerous blue and white colonies on the agar plate.

 

a. What do blue colonies signify? Briefly explain your answer.

 

b. Which colonies (blue, white, or both) would you want to pick for further analysis to check for the successful cloning of the INS gene? Briefly explain your answer.

 

c. If you forgot to add X-gal to the agar selection medium, how would the colonies that grow differ phenotypically from the ones that grow in plates with X-Gal? Briefly explain your answer.

 

d. If you forgot to add ampicillin to the agar selection medium, what other colonies would grow that won’t normally grow in plates with ampicillin? What color would those other colonies most likely be? Briefly explain your answer

DISCUSSION 2

short response

Discussion Post (1-1 and a half page) due by Wednesday Feb. 10, 2016 10:00 am

As you progress through your program, you will be exposed to many problems related to the field of education as well as many stakeholders and leaders who influence and who are influenced by those problems. No research study is done in isolation, and all studies need to consider and identify the key stakeholders and their roles. Stakeholders form a system of checks and balances in an organization. While each stakeholder has the right to an opinion, the influence of that opinion may relate to the position or role that the stakeholder holds within an organization. In addition, the characteristics and actions of a leader looking to address these problems need to be effective in order to affect positive social change.

Note: This Discussion has two parts. Be sure to address each part in your response.

To prepare for Part 1 of the Discussion, consider educational leaders in your field that you know (Note: Field is High School Counseling). Think about how these educational leaders exemplify or do not exemplify the concepts related to leading positive social change. What did the leaders do well, or what did they not do well, especially when initiating change? In addition, identify one scholarly resource on change leadership related to your post to share with your colleagues in the Discussion.

For Part 1 of the Discussion, post a description of the characteristics of an effective leader of change by providing specific examples from your own experience with leaders. Explain why leaders need to have these particular characteristics to effectively initiate change. Be sure to include a reference to the scholarly resource you identified on change leadership, and explain how the reference relates to your post.

Be careful not to identify anyone by name. The emphasis in the assignment is not the individuals themselves; instead, it’s how you perceive their leadership skills and approaches.

To prepare for Part 2 of the Discussion, reflect on the problem statements you discussed in the Module 4 Discussion, and select one problem statement to address for this part of the Discussion. Think about the key stakeholders in relation to your problem statement, and consider why these stakeholders are relevant to the problem. What questions, related to the problem, might you ask these key stakeholders?

In determining key stakeholders, you might ask yourself:

• Who will I need to obtain approval from in order to explore this problem?
• As it pertains to stakeholders, what are the risks and benefits of exploring this problem?
• Who will I need to involve as participants in exploring this problem?
• How will the possible outcomes of exploring this problem positively or negatively impact the stakeholders?

 

For Part 2 of the Discussion, post the key stakeholders related to your selected problem statement with an explanation as to why these stakeholders are relevant to the problem. Then, identify at least four questions about the problem that you would like stakeholders to respond. Finally, explain why the responses may be important in order to understand and address the problem.

BUS 605 WEEK 4 DISCUSSIONS